Skip to content

Micropetastases and Survival w stadium II Rak jelita grubego ad

4 tygodnie ago

467 words

RNA wyekstrahowano za pomocą Trizol (Life Technologies, Gaithersburg, MD) w jednoetapowej metodzie, jak opisano wcześniej.16. RNA oceniono spektrofotometrycznie i elektroforetycznie na 0,8% żelu agarozowym w celu określenia jego integralności i ilości. PCR odwrotnej transkryptazy
Zagnieżdżony PCR przeprowadzono zgodnie z metodą opisaną przez Gerharda i wsp. [13] Krótko, wytworzono komplementarny DNA (cDNA) z odwrotną transkryptazą wirusa ptasiej mieloblastozy (Boehringer Mannheim, Mannheim, Niemcy) z użyciem 2 .g całkowitego RNA i startera B w objętości reakcyjnej 20 .l. W pierwszej rundzie PCR, 100 .l reakcji przygotowano z 15 .l preparatu cDNA i startery A i B.13 Probówki reakcyjne umieszczono w termocyklerze i wstępnie ogrzano do temperatury denaturacji; po początkowym denaturowaniu w 95 ° C przez 7 minut, 20 cykli amplifikacji przeprowadzono w 95 ° C (przez minutę) i 72 ° C (przez 2 minuty), z końcowym etapem wydłużania przez 10 minut. Wszystkie mieszaniny przygotowano na lodzie w stacji roboczej PCR (CBS Scientific, Del Mar, CA).
Do drugiej rundy PCR przygotowano mieszaninę reakcyjną zawierającą starter A i wewnętrzny primer C13, i do każdej probówki dozowano 96,5 .l. Probówki pokryto olejem mineralnym i przeniesiono do innego pomieszczenia, w którym 3,5 .l pierwszej mieszaniny reakcyjnej przepuszczono przez olej za pomocą samouszczelniających sterylnych końcówek filtrów (Biozyme, Landgraaf, Holandia), aby zapobiec zanieczyszczeniu krzyżowemu.
Piętnaście kolejnych cykli amplifikacji przeprowadzono w tych samych warunkach, z tym że jako temperaturę hybrydyzacji wybrano 69 ° C (przez jedną minutę). Produkty PCR rozdzielono na 2% żelu agarozowym i wybarwiono bromkiem etydyny. Próbki kontroli negatywnej, które były koamplifowane w każdej procedurze PCR nie dawały żadnego produktu, gdy stosowano ten protokół. Jednak w niektórych próbkach z kontrolą ujemną można było wykryć bardzo słabe pasmo, gdy w drugiej analizie PCR użyto 20 lub 25 cykli. W konsekwencji doszliśmy do wniosku, że 15 cykli było wystarczających w naszym teście.
Skuteczną amplifikację RNA monitorowano za pomocą kontrolnego PCR cDNA fosforybozylotransferazy hypoksantyny (HPRT) z użyciem startera H1 (5 ACCGGCTTCCTCCTCCTGAGCAGTC3 ) i startera H2 (5 AGGACTCCAGATGTTTCCAAACTCAACTT3 ). Siedem węzłów chłonnych od dwóch pacjentów, jeden leczony z powodu niedokrwiennego owrzodzenia i drugi z powodu gruczolaka kanalikowatego, zastosowano jako kontrole negatywne. Ponadto, przeprowadziliśmy reakcję kontroli negatywnej, stosując potwierdzony przerzutowy węzeł chłonny, pomijając dodanie odwrotnej transkryptazy w celu sprawdzenia możliwości zanieczyszczenia genomowego DNA.
Analiza statystyczna
Pierwszorzędowym punktem końcowym było przeżycie mierzone od daty operacji do czasu ostatniej kontroli lub śmierci. Sporządzono krzywe przeżycia Kaplana-Meiera. 17 Dla całkowitego przeżycia wszystkie zgony, niezależnie od przyczyny, uznano za zdarzenia. Dla skorygowanego przeżycia rozważano tylko zgony związane z rakiem; Dane dotyczące pacjentów, którzy zmarli z innych przyczyn lub którzy wciąż żyli pod koniec naszego badania, zostały ocenzurowane. Wskaźniki nawrotu były obliczane od czasu operacji do czasu nawrotu za pomocą tych samych metod
[przypisy: buprenorfina, Białkomocz, dekstrometorfan ]
[patrz też: columbex opole, alergopneuma, bendiks rzeszów ]

0 thoughts on “Micropetastases and Survival w stadium II Rak jelita grubego ad”

  1. [..] odnosnik do informacji w naukowej publikacji odnosnie: stomatolog włocławek[…]

  2. Oprócz tego że masz problemy z tarczyca to prawdopodobnie cierpisz na tężyczkę utajona